Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14965B2
Clone ID IST14965B2
Vector VICTR76
Project tigm

Sequence tag IST14965B2HMR1
Sequence
CTACCTCCCCCAAGAACAAGAACTAAAGGATTCTGTCACCATGCCCAGTTTATGTAAAACTGAATAATGAGCCTGGGGCT
TCATGCATTTTAGGTAANCATGCTACAACTAATTAGATCCTAGCCACAAGGATTAGTCCTTTTGTTTTTGTTTGTTTATT
TTTTTTGTTTTTTGTTTTGTTTTTTTTTNNGGTTTNCNTNNNAN
Sequence Type genomic DNA
Unitrap ID UNI10851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70335810..70336004 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]


Sequence tag IST14965B2HMF2
Sequence
GTAGGAGGATCAAAAGTTCAAAGTCATCTTTGCCTAACTACTAAGTTCAAAGCTAGCATGAGATACATGAGACTCTACCT
TAAAGAATAATAATATTTTTAACCCATGTAAAAGAATTCTCCAGGACAATGCTGAAACAATTTAGCAATTAAGTAAGTTA
GTTTCTAACTTCCATTAAGAACAGACATTCAGCCGGGCGTGGTGGCGAACGCCTTTAATCCCAGCACTCGGGAGGTAGAG
GCAGGCAGATTTCTGAGTTCGAGGCCNGCCTGGTCTACAGAGTGAGTTCTAGGACAGCCNGGGCTACNCAGAGAAACCCT
GTCTCGAAAAACCNAAAACCNAAAAAAAAAAANNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70336001..70336352 342
 
EST/CDNA Est Name
  CJ076210.1 - BY217457.1 - CJ178484.1 - CJ165611.1 - CJ171247.1 - CA883725.1 - CJ161536.1 - BY213411.1 - CJ162775.1


Sequence tag IST14965B2BBF1
Sequence
CACCAAGTAGAGGCCGAGCTGAGCTCTTCTTGCCGGACGCCTTCGAGCCNCCTGTCAGAAGGCAGGACTCTGAAGGAAAC
CGAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 137526969..137527057 87
NO GENE  

 
Come back to gene CJ076210.1 - BY217457.1 - CJ178484.1 - CJ165611.1 - CJ171247.1 - CA883725.1 - CJ161536.1 - BY213411.1 - CJ162775.1


For any suggestions or comments, please send an email to unitrap@crg.es