Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_341C8-3
Clone ID CMHD-GT_341C8-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_341C8-3
Sequence
CTTTGGCTCAAAGGAGTCGTGTTCAGTGTCACAACCGTTGACCTGAAAAGGAAACCTGCAGATCTACAGAACTTGGCTCC
TGGGACCCACCCGCCATTTATAACCTTCAACAGCGAAGTCAAGACGGATGTGAATAAGATTGAGGAATTTCTCGAAGAAG
TCTTGTGCCCACCCAAGTACCTAAAGCTTTCACCAAAGCACCCAGAGTCGAACACTGCTGGAATGGACATCTTTGCCAAA
TTCTCTGCTTACATCAAGAACTCAAGACCAGAGGCTAATGAAGCGCTGGAGAGGGGGCTCTTGAAAACGCTGCAGAAACT
GGATGAGTACCTCAACTCTCCCCTCCCCGACGAAATCGACGAGAACAGCATGGAGGACATCAAATTTTCCACACGTCGGT
TTCTGGACGGCGATGAGATGACATTAGCAGACTGTAACCTGCTGCCCAAGCTCCACATTGTCAAGGTGGTGGCCAAAAAA
TACCGCAACTTTGATATTCCCAAAGGAATGACAGGCATCTGGGGGTACCTGACAAACGCCTACAGCAGGGACGAGTTCAC
CAA
Sequence Type mRNA
Unitrap ID UNI13202

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 134773083..134782092 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037242 (Clic4) NM_013885 chloride intracellular channel 4 (mitochondrial) Gene [Source:MGI (curated);Acc:Clic4-001]

 
Come back to gene ENSMUSG00000037242


For any suggestions or comments, please send an email to unitrap@crg.es