Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10170A11
Clone ID IST10170A11
Vector VICTR76
Project tigm

Sequence tag IST10170A11HMF1
Sequence
ATGTGAGAAAGCGCCGTCTCCATTTTGTGTTACATCCTGGTTGTAACCCTGCAAGAGTGATCTAGAGCCTCTCTCTTCCC
GTGGCATGGTGGTCTGGCAAGAGCATGATGCACTTGAGTGCAAGCCTGCGGGCCACTAACCCCGCCCCCACCCCTCTTGC
CCACAGATGCAGGCATCGGGAGCCGCCTCCTGGCAGGTAGCACCACAGGTGCCCTGGCCGTGGCTGTAGCCCAGCCTACA
GATGTGGTAAAGGTCCGCTTCCAGGCTCAGGCCCGGGCTGGTGGTGGTCGGAGATACCNNAGCACTGTCGAAGCCTACAN
NACCATTGCACGAGAGGAANGGATCCGGGGCCTCTGGAAAGGTGTGTGCTGGGTGTTGGCTTTTCTCCCCTCCTCTCCTC
CATGCNCTGGGCTCACACAGGTTCTCTTTTCTACAGGGACTTCTCCCAATGTTGCCCGTAATGCCATTGTNNACG
Sequence Type genomic DNA
Unitrap ID UNI20153

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 107646421..107646890 458
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033685 (Ucp2) NM_011671 uncoupling protein 2 (mitochondrial, proton carrier) Gene [Source:MGI (curated);Acc:Ucp2-001]


Sequence tag IST10170A11BBF1
Sequence
ATGTGAGAAAGCGCCGTCTCCATTTTGTGTTACATCCTGGTTGTAACCCTGCAAGAGTGATCTAGAGCCTCTCTCTTCCC
GTGGCATGGTGGTCTGGCAAGAGCATGATGCACTTGAGTGCAAGCCTGCGGGCCACTAACCCCGCCCCCACCCCTCTTGC
CCACAGATGCAGGCATCGGGAGCCGCCTCCTGGCAGGTAGCACCACAGGTGCCCTGGCCGTGGCTGTANCCCAGCCTACA
GATGTGGTAAAGGTCCGCTTCCNNGCTCAGGCCCGGGCTGGTGGTGGTCGGAGATACNNNNNCACTGTCGAAGCCTACAN
NACCNTTGCACGANNGGAAGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI33530

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 107646421..107646765 319
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033685 (Ucp2) NM_011671 uncoupling protein 2 (mitochondrial, proton carrier) Gene [Source:MGI (curated);Acc:Ucp2-001]

 
Come back to gene ENSMUSG00000033685


For any suggestions or comments, please send an email to unitrap@crg.es