Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BA0069
Clone ID BA0069
Vector pGT2lxr
Project sanger

Sequence tag BA0069
Sequence
GATCGACCTCCCCGGGCATGAGAGCTTGAGGTTTCAGCTCTTAGATCGCTTTAAGTCTTCAGCTAG
Sequence Type mRNA
Unitrap ID UNI2005

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 103099868..103099933 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032553 (Srprb) NM_009275 signal recognition particle receptor, B subunit Gene [Source:MGI Symbol;Acc:MGI:102964]

 
Come back to gene ENSMUSG00000032553


For any suggestions or comments, please send an email to unitrap@crg.es