Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12342B4
Clone ID IST12342B4
Vector VICTR76
Project tigm

Sequence tag IST12342B4BBF1
Sequence
CTGTCTTCAGACACACCAGAAGAGGGAGTCAGATCCG
Sequence Type genomic DNA
Unitrap ID UNI29135 UNI33532

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 46391885..46391920 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 46865180..46865215 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021375 (Kif13a) NM_010617 kinesin family member 13A Gene [Source:MGI Symbol;Acc:MGI:1098264]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 46394420..46394455 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 55153470..55153505 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 59249654..59249689 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 14853505..14853540 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 33198259..33198294 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 73553446..73553481 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 28254383..28254418 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031488 (Rab11fip1) NM_001080813 RAB11 family interacting protein 1 (class I) Gene [Source:MGI Symbol;Acc:MGI:1923017]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 116457170..116457205 36
NO GENE  

 
Come back to gene ENSMUSG00000031488


For any suggestions or comments, please send an email to unitrap@crg.es