Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14540C9
Clone ID IST14540C9
Vector VICTR74
Project tigm

Sequence tag IST14540C9HMR1
Sequence
AGGAAGGCAGCAGGTGCTGTTAGAGGCGCAGGTGGGCTATGGTTGCTCACTCTCCTCATCGGTAACCCCACCGAATGCTG
GGCCATTTAAATGCCCCAAGACCATGGATGGGGACAGCCCAGCCTAGCTCAGGCTATAGCTTGATCATTGGATCAGGGTT
GTGGATGTCTCTTACTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104163267..104163444 178
NO GENE  


Sequence tag IST14540C9BBF1
Sequence
CGCATGCCCCCACCCTCGGCCAGCCTGCTTCCCCTCTCACCAGGCTGCTCTGANTGACGGCCCTGTGTGCTGTGTGATAC
TAATGATGTGAGACCTCGAACATTTGAGGACTAAGAAAATCAGCCGGTTTCAACCAAAGGACGCTCATTCCACCACCCCT
GAACTCCTGATGTCCCTGTGAACTTAANCACGGGGCATCACGTGCACTCTCTATTTTATATTTTACCAGCTCGTGTGGCC
NGNNNNNNNNNNNNNNNAAATGACGAGAAGAAAGCCAAGGTAAGCTACTGACCCGCCGGTCCTANAAGGCTCTGCTTCCT
GCCTGTGTTNGTTCNTGCCGTAACNTGTGGANNNNNTGTGTCAN
Sequence Type genomic DNA
Unitrap ID UNI14237

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104163446..104163808 236
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]


Sequence tag IST14540C9HMF2
Sequence
GTACAACGGGTCACACTGCACGGGCTTGTTCGCTGGGCTGTGTGGATTCTGGAAGTAGCTTTAGTGTAGTACAGAGGACA
GGAGTATGTTTATCCTAATTGCACACTCTGGAACCAGGGAAACAACCTCAGGATGAGTCTGGGGACCCACTGAACCTACT
GTGAGTCAGACATCAGCCAAAGCTCCATTAATCACCTGACCTCCATAAGCCCCTACTTTAACTGGATGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 60644183..60644414 232
 
EST/CDNA Est Name
  AI195350.1 - BY792697.1 - BY330376.1 - BY186606.1 - BY219742.1

 
Come back to gene AI195350.1 - BY792697.1 - BY330376.1 - BY186606.1 - BY219742.1


For any suggestions or comments, please send an email to unitrap@crg.es