Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_334H7-3
Clone ID CMHD-GT_334H7-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_334H7-3
Sequence
GTCAGTAAGGCCTTTTTTTCCGCGAGCCACATTTTGAAAAAACCGGAGTGAAATTCCTCAGTTGCTCCTTAAGCTGTATG
CCACCAGCCATCTGCACAGTGACTTCGTTGAGTGCCAAAGCATTCTCAAGGAGATTTCTCCTCTTCTCTCTATGGAGGCT
ATGGCGTTTGTAACTGAAGACAGGAAATTTACTCAAGAAGCTACATACCCAAATAAATAAATTTTTGACTTATTTGGAGG
TGTTGATCTTCTTGTAAAAATTCTTATGAGGCCTACCATCTCTATCCGGGGAC
Sequence Type mRNA
Unitrap ID UNI13213

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155496776..155498853 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038324 (Trpc4ap) NM_019828 transient receptor potential cation channel, subfamily C, member 4 associated protein Gene [Source:MGI (curated);Acc:Trpc4ap-002]

 
Come back to gene ENSMUSG00000038324


For any suggestions or comments, please send an email to unitrap@crg.es