Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_345D2-3
Clone ID CMHD-GT_345D2-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_345D2-3
Sequence
TTTTTTTTTTTTCGGCCCAGAATGCAGCAACATCCTCATCATAACCGTCCGAAGGAGCCAGAGTTTTTTACAGCTGGATC
TAGACTTTATCCTCGGTTTCCTTAAGAACCCCTAGAGGTTCAATGTTGCTGTGACCCGAGCCAAGGATTTGATCATCAGT
AATGGGCAACCCCCTCCTCCTAGGCCACGACCCAAACTGGAAAACGTTCCTGGAGTTCTGTAAAGAAAACGGGGGATATA
CCGGGTGCCCCTTTCCTGCCAAACTGGACCTGCAGCAGGGACAGGACTTGCTCCAAGGTCTGAGCAAACTCAGCCCCTCT
ACCTCAGGGCCCCGCCGTCACCAGAATCTCCCCCAGGAGCGGGAGGGTGAAGGGGGCCTGCCCTTACAAGTGGAGCCAGA
GTGGAGAAATGAGCTCTGAGGCCACAGCCGCCCGCCTTCTCACACCAGCCAAGCCTTATTGCTGCCTATCCCTGACCCAG
AACCCAGCTCTCCTGTCCCTGCAAGAGATGGGAAGGCCGGGAAGTTTACAGCCCAGACCATTCCGCCCCTTCCTCTGCTA
GGAAAGACAACCCAAGCTGCTAAAACTCGGAGGAAGGGGGAGGAAGAAAGC
Sequence Type mRNA
Unitrap ID UNI13215

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 104597875..104598879 285
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002227 (Mov10) NM_008619 Moloney leukemia virus 10 Gene [Source:MGI (curated);Acc:Mov10-002]

 
Come back to gene ENSMUSG00000002227


For any suggestions or comments, please send an email to unitrap@crg.es