Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12253B6
Clone ID IST12253B6
Vector VICTR76
Project tigm

Sequence tag IST12253B6HMF1
Sequence
TTACAAATATTTAATTTTGAAAACCTCCATATTAGCTGGTATTTTTAGATACTGGGACTTCATTGTGTGAACAAAAATAT
TTGAATTTGTACTCTTATGAAGCTTAAATTCTGGATGGGAGAGGCATGATATTTAAAACATCAGCATTATCACAGAAAAG
AAAGTGATACAAGGCAAGAGAGAGACAAATGGAGTGTGTTTAGCTGGATAGAGAACGTATACAAGCTGGGTGCATGCCCA
TCATAGGAAGGTGAGGCAGGAGGGCTGTTTTCCACACTAGATGGTGGCATGAGTCTGGGGGAGAGAGTCACATGCAATAG
CCAGCTTTACTCAGAACATCAGAAGAATCACATGAGTAAGGTGTTCAATCACAAGGACAAGCCACAAGCCACAAAAACAC
GTTTTTCTATAGAGGCACATGAACAACAGCAGCTGAAATAAATTCACTTCTATTTGCTATTCTGGGAGGAACCCCAGANA
TCTGACNCCCTCTTCTGGCTCCACAGGTACCANCACTCACATACNCAGAAATNAAAATACNATN
Sequence Type genomic DNA
Unitrap ID UNI33535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3228344..3228886 531
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053263 (OTTMUSG00000007639) predicted gene, OTTMUSG00000007639 Gene [Source:MGI Symbol;Acc:MGI:3649892]


Sequence tag IST12253B6BBF1
Sequence
TTACAAATATTTAATTTTGAAAACCTCCATATTAGCTGGTATTTTTAGATACTGGGACTTCATTGTGTGAACAAAAATAT
TTGAATTTGTACTCTTATGAAGCTTAAATTCTGGATGGGAGAGGCATGATATTTAAAACATCAGCATTATCACAGAAAAG
AAAGTGATACAAGGCAAGAGAGAGACAAATGGAGTGTGTTTAGCTGGATAGAGAACGTATACAAGCTGGGTGCATGCCCA
TCATAGGAAGGTGAGGCAGGAGGGCTGTTTTCCACACTAGATGGTGGCATGAGTCTGGGGGAGAGAGTCACATGCAATAG
CCAGCTTTACTCAGAACATCAGAAGAATCACATGAGTAAGGTGTTCAATCACAAGGACAAGCCACAAGCCACAAAAACAC
GTTTTTCTATAGAGGCACATGAACAACAGCAGCTGAAATAAATTCACTTCTATTTGCTATTCTGGGANGAACCCCAGANA
NCTGT
Sequence Type genomic DNA
Unitrap ID UNI33535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3228403..3228886 478
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053263 (OTTMUSG00000007639) predicted gene, OTTMUSG00000007639 Gene [Source:MGI Symbol;Acc:MGI:3649892]

 
Come back to gene ENSMUSG00000053263


For any suggestions or comments, please send an email to unitrap@crg.es