Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_345A12-3
Clone ID CMHD-GT_345A12-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_345A12-3
Sequence
TTGCAGAATTTAAGAAGACAGACGAGAGTATCCTGGTCAGCCCCACAGGCCTCTCCAGAGTGGCCTTTAACCCTGAGCAG
AGGCCACTCCACGGAGGGCTGAAGACCGCCACGAGCTCCCCGGCCAGCACTCCTCTGTCGCCCATGAGGCTACCAGCCAC
CACCCCAAAGAGAAGGCCAAGGGCTGCGGACTTCTTCTGAGAGCCAGAAGCCCTTTCTGAAGCCTGCTTTTATACCGGAT
GTTCTATAAATTATAACTTT
Sequence Type mRNA
Unitrap ID UNI10863

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32197290..32197546 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058392 (Rrp1b) NM_028244 ribosomal RNA processing 1 homolog B (S. cerevisiae) Gene [Source:MGI (curated);Acc:Rrp1b-001]

 
Come back to gene ENSMUSG00000058392


For any suggestions or comments, please send an email to unitrap@crg.es