Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_345H9-3
Clone ID CMHD-GT_345H9-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_345H9-3
Sequence
GAAGGATATGGGAGAGAGATTTAAAAGCTGACCCAAATGTACTGCTCAGCAGTTCTAGCCAAGAGGTCACAAAGGATCTG
CTAGACATGATTGACCATACAAGTATCCGAACTATTGAAGAATTGGCTGGAAAACTAGAATTTGAAAATGAATTGAACCG
TGTGTGTGGACACTGCCAAGATTCACCCTTCAAGGAGGAAGCCTGGGCCCTGCTTGTGGATGAGAGTCCTCAGAAGGCTC
TGGATGCTGACCCTGGTATCCTCAAGCAGGCTTTGGATGATCAGAATATAGTTGAGACTGTTCTGGACTTGGAAGAAGAC
TACAACTTGATGACTTCTTTTAAATACCAAATAGAGTGAGGAGAGTGGATGTCAGCAGCCACAGTGGTTACCAGAACAAG
TCTTCACGAGGGGTTGGCAGAGCCCAAATTGCCACACCTTGTTTAATTTCTGCTGAATCCCATTTTGAGCTGAGAGCCCA
GGTTTTAGTTCTGTTATTTTGAAATGTTTGAAAAGTTTTTTTTGGACTTGACATTTTTTTTAAAGTGTATTCTTGGTTAG
TGTTGAATATATACAGTCCCCAGGATAGGTTATAGGTTGTGCCTCTGCTCTTTGTCCTTGTATTCTTTTATATGAATCCC
TGGAAAAATAAAAATCCAGGAACC
Sequence Type mRNA
Unitrap ID UNI13219

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108297625..108300094 570
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032611 (1700102P08Rik) NM_053216 RIKEN cDNA 1700102P08 gene Gene [Source:MGI Symbol;Acc:MGI:2148248]

 
Come back to gene ENSMUSG00000032611


For any suggestions or comments, please send an email to unitrap@crg.es