Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14559D4
Clone ID IST14559D4
Vector VICTR74
Project tigm

Sequence tag IST14559D4BBF1
Sequence
CGGTTGCNNGAGAANAANGGCTGCCAAGTCNNGAGTGGGAACCCCCCCCGGAACTCTGCANCANCGCGACCCCAAGGAGA
GGAGCGAAGAGTCTCGCGCGTGAGAGGCCTTGGAAGCGTGCTGTCGTTCTTGCTGAGGCTCACGGGAGACGTANTCCGAG
CGAAGGGGGCCGATCCGGCGGAGCANATGCAGGATTGGCCGGGCTGGTAGGGCAACGCGCGAGGCGGGGCGTTCTCTGAG
TGGCAGTGGGACGTGCTCGGTGTCACTTCCTGGAAGTGCCCCAACCTCCTGGGGCTCTCCCACGCGTCANAGGTGAGCTC
ACTCCTAGCTGGGCGGGCGCAGCTTCATAATCCGGCTCCTCGGATCACCGAGAGCACCTCCCAGCCGTCGGACCCACCCC
TTTCCTGTGTCAGANCCTGACACCCCAACTCTTGAGTTTCTCCAGANCN
Sequence Type genomic DNA
Unitrap ID UNI30128

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13563256..13563701 422
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033961 (Zfp446) NM_175558 zinc finger protein 446 Gene [Source:MGI (curated);Acc:Zfp446-001]


Sequence tag IST14559D4HMR1
Sequence
NCGCAGCCGTAGGACTCACGTAGGACGGAGCCGACTGTGGGTTAGCCTCCTTACGCATGTGCGCAACGGACCTGGTTTCT
ATT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13563176..13563257 82
NO GENE  

 
Come back to gene ENSMUSG00000033961


For any suggestions or comments, please send an email to unitrap@crg.es