Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_345E7-3
Clone ID CMHD-GT_345E7-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_345E7-3
Sequence
TATCCCGGCTGCACTGTGAGAGTGAATCTTTCAAGATGGACCTCATCTTAAATGTAAACATTCAGATTTACCCTGTGGAC
TTAGGTGACAAGTTCCGGTTGGTTATAGCTAGTACTTTGTATGAAGATGGTACCTTGGATGATGGTGAATACAACCCCAC
AGATGACAGGCCTTCCAGGGCTGACCAGTTTGAGTATGTCATGTATGGGAAAGTGTACAGGATCGAAGGGGATGAGACCT
CCACTGAAGCAGCCACACGCCTCTCTGCGTACGTGTCCTATGGGGGCCTGCTCATGAGGCTTCAGGGTGATGCCAACAAC
CTGCATGGATTTGAGGTGGACTCCAGAGTTTATCTGCTGATGAAGAAGCTGGCCTTCTGAACTTCGTGGGAAACCAGACT
TGCTGCTTAGTCACTCATGTCATGGACACTGTTCAAGGCTGTGTAGAAGCTGTCGGTGTTAGCCTGTAAAAGGGGCGGAA
CTCTGTCCACTGTGGGGACGTCTTCAGTTTGTCTGAATGCAGTGGAAAACCGACTCTCCCTCTCGGAAGGCCGAGAGGGA
GAACTTAGCATGAACCTGAAGTTGTATATGATTTTTTTTATTAAAGTTTTCTTTTCC
Sequence Type mRNA
Unitrap ID UNI13229

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20718897..20722335 353
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021018 (Polr2h) NM_145632 polymerase (RNA) II (DNA directed) polypeptide H Gene [Source:MGI Symbol;Acc:MGI:2384309]

 
Come back to gene ENSMUSG00000021018


For any suggestions or comments, please send an email to unitrap@crg.es