Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12479E8
Clone ID IST12479E8
Vector VICTR76
Project tigm

Sequence tag IST12479E8BBF1
Sequence
AGAGATAGTTATGAACTGCCCCATATTGGTGGAATCAAACCTGGGTTCTCTGGAATAGTATACTTAGCTACTGAGCCATC
TCTCTAGCCCCTGCTTGAATGCACTTAACATGACTGAAGCCTAAGAAACAACTGAGATCAGATAACAGGGGGAAGAAATC
CAAATTAGAGAAATGGCTCAGTGGTTAGGAGCCCATGCTGTTCTGGCAGAGGACACTAATCCAATTGCCAGCACCCACAT
GAGGCAACTTCCAGCTTCAGGAAGCAAACATCTCTCTGAGGTCTTTGGGTATATACATAGACTGCACACATACACAAGAT
AGTAAATATATTACCAGAGGCTAGAGACATGACTCAGCAGTTAAGAACACTGACTCAATTTCTAGCAACTACAGAGCAGT
TCATGACTGCCTATAATTCTATTTCCNGAGGANCCATCACTGTCTTCTGACCTACAAGGGCACCAGGCACATAGCGCACA
GACATCCNTGCNNGCCAAACACCCACACATATAAGTNAAAATATATAACCTGCCTAAGTN
Sequence Type genomic DNA
Unitrap ID UNI7287

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134173629..134174167 527
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030677 (Kif22) NM_145588 kinesin family member 22 Gene [Source:MGI Symbol;Acc:MGI:109233]


Sequence tag IST12479E8HMF1
Sequence
AGAGATAGTTATGAACTGCCCCATATTGGTGGAATCAAACCTGGGTTCTCTGGAATAGTATACTTAGCTACTGAGCCATC
NCTCTANCCCCTGCTTGAATGCACTTAANNTGACTGANNCCTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000030677


For any suggestions or comments, please send an email to unitrap@crg.es