Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14466G4
Clone ID IST14466G4
Vector VICTR74
Project tigm

Sequence tag IST14466G4BBF1
Sequence
GTAGAGTGATGGGGGAAGGGGTAGGGTCCTCATGGGGGTTTGAAAAGGGATGGTCTAGTGGGATTAGTGGGAGAGCCTAT
GCTCCATTGTCTCCTACTAGATCACGAGTTCACGGAAAACTGCGGGCTCAATGACTTCGGCGATACTGTAGCACATCCTT
TCAAAAAGTGTTCCCCTGGGTATTGCAACCCCAATGGCACAGAGCTGTGTAGCCAGTGTAGCAGCGGAGCCGCCGCAGCC
CCAGCTCACGTGGAGAGCCCTGGTAGAACCCACAAGCAGTGTAGAAAGGTGCTAGACTCCTGGGGTATGAGTCAGGGCTT
GCCTGTGGTTCCATGGGTAAAGCTTGGGTCAGAGGGGGAGCCTCACCCCAAGTGGAGTGCCTGAAAGGGGGGGATGAGGC
AGGGAGAGGAGAGGGAGCTCCATTTAGGGACCTAAGGGATGGGAGGCTTGGGCNNAAGGGTCCTCTTGTTTNNCTCTCAA
ACCTCTGTTCCCAGAANCCCGTCCCTCCN
Sequence Type genomic DNA
Unitrap ID UNI33538

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 31351668..31352175 498
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036826 (Tmem149) NM_145580 transmembrane protein 149 Gene [Source:MGI Symbol;Acc:MGI:3655979]


Sequence tag IST14466G4HMR1
Sequence
CTACNNAGCCCTGCCCTCACTATAAATAAAGCCTACCTAAGTCCATTCTCCCCATGTCCTCCACTCAGAGGTAAAGTTTG
CTCTTGGTGTCCCCATTGTAACTGGTCTTTTCTGCACAAGCTTAACCTGTGTCCACCCCCACAGCCTTACCTGCCTAAGA
CCCANCACACCTACTCCCCAAAGAAGCCTACTGCAAGGCCGGCAACAACCTTGCCACTTGCTAGCGTCCCTGTTCTCTAC
ACCATCTAGTGCACACCCAGTCACTGCTCACCAGGACATGCAGGAGGCCCAAAGCGTTGCANGCANCGGCTGCANCACCT
CTTGTCANAGTTCCANTACTCNNGGTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 31351322..31351671 330
NO GENE  

 
Come back to gene ENSMUSG00000036826


For any suggestions or comments, please send an email to unitrap@crg.es