Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14389C5
Clone ID IST14389C5
Vector VICTR74
Project tigm

Sequence tag IST14389C5HMR1
Sequence
GTGTTTGACCCATGGGATAGGAGTCNNCCCTTCCTATATCCTGGACCCACCAGTGTANTGAGTGGATGTCTGCTCCCTTG
GTTNNNAGGAACTTATACAATAATCAACAACAGCAGCACATGGCCTGTANATAAGCTAGGCTGCCTCCTCTTGGCTGTGC
TCCCAACCCATGGCTTTTCCTCACGACTCCCTTAGTCCTTGGCTTTGAAAGCTGCCCGTATTTTTGCATTTCTTGCTCAT
TGACATTANAANTCC
Sequence Type genomic DNA
Unitrap ID UNI16792

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 6098617..6098870 236
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046792 (Zfp787) NM_001013012 zinc finger protein 787 Gene [Source:MGI Symbol;Acc:MGI:1914359]

 
Come back to gene ENSMUSG00000046792


For any suggestions or comments, please send an email to unitrap@crg.es