Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15088G11
Clone ID IST15088G11
Vector VICTR80
Project tigm

Sequence tag IST15088G11BBF1
Sequence
CCCCTTCTGGGTACTTAGCATGCACTGTCCCGTTGAGACCTCACAGCTGTGACAAGGGCACTGATAATTCCTTTTGCTTC
ATGTGTGAGGAACCTGGACTCAAATTACAAGTCCAAAGTGAAATGGGTAGCAAGTGGGAGAATGAGTGTGACCTCAAAAC
CCTGGGGTCGAAGACATTCTCAGCCTGTTTACCAGTCTAGGCTTTCAGTCCACTATGAAACAACCTGTTCTACACAATAG
TTTCCAGTAATTCTAGCATGAGTCTGTCAGAAAAAACAACAAAACAAAACAAAACAAAACAAAACAAAACAAAACAAAAC
AAAACAAAACAAAACAAAACTGANGCTATCGGGTCCATAGCAACATGCAGTTTAGATTTTGTCTGACATACACAAATCAG
CACTAGGGAATTTTAAGCNTTCCAGANNNGGGTGTTGGTGCATACCTCTCTCAGCAGANCTCTTCCTCTGACTTTGGAAA
GCTTTTTGNTANGGTAATTNNNAAGTCCNAACAAGAN
Sequence Type genomic DNA
Unitrap ID UNI31478

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 42249973..42250489 489
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057719 (Sh3rf2) NM_172966 SH3 domain containing ring finger 2 Gene [Source:MGI (curated);Acc:Sh3rf2-002]


Sequence tag IST15088G11HMF2
Sequence
CTAAAACCACCGAGTGTGACAGCCTCCAGTCCTGCCTGCTCACAATGCCAGGTTACTCTTCTCAAGTCATTTCATACGTC
TGTCCCCTTGCACACAAACCAACAGGAACTCCTATTTATCCAAACACCCTGATCACTATGCAACATCTTGTATAATCTTG
GTGTAGAAGAACAAAGAAAGGGTCCGGGTGAGGAGCTAGATAAATATCCAAAGAGAATGGAGACCCTCCAGTGGCAGGAA
GACAGATTTCTTACTTGGCCTTTCTGCACTGTAATTCACATATTTTACGTGAATGCACCCTGATTTTACAGTGAGGAAAA
TGCTACTGCTCCTCTCCCACCTGCACCCTTTTCCCAGCACTGACCTTTCTGCCNACCATACCCATTCATGCCTCTGCTCA
GCTCTGCTCTCATTCNANCCCAACTCCTGCCCTGCANGGAGCAGCTNANCTGCTTCCTTTGNNNANGAANCCTGAACCCC
TGANTCTATAGGGACCTCCCCCGCCCCNNCTNATCTTCANTGACNACTATACAACTTGATNNTACCATGCAANCCTGNTC
NNNANANNTGCNNNTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 42070742..42071301 518
NO GENE  


Sequence tag IST15088G11HMR1
Sequence
TTAGCATTTAAGAGTTGGGACTTGGGACTGGAGATATGGCTCAGTAGCTAAGAGCACTTGTTGCAGATTCCCAGTCCCCA
CACGACAGCTCACTGCCATCGGTTACTCCGCTTTCACTGCCCCTTCTGACCTTGAGGATTCTAGGCATCCATGTGGCTCA
CAGATACACATGAGCAAATCATTCATATATATAATTAAATAAAATTTAAAAAGTTTAAAAACAGATTTGGAATTCATTTA
ATCACTCATCTACCTCATAAATGTCAGGTTC
Sequence Type genomic DNA
Unitrap ID UNI14313

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 42071298..42071567 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025171 (Ubtd1) NM_145500 ubiquitin domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2385092]

 
Come back to gene ENSMUSG00000025171


For any suggestions or comments, please send an email to unitrap@crg.es