Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14226F2
Clone ID IST14226F2
Vector VICTR74
Project tigm

Sequence tag IST14226F2BBF1
Sequence
AGGAGAGTGAAGCAGAGTGATCAGACTGAGGATAGCCTGGGCAACCTAGTGAGCTTCAAGCTAATGTTAACTACACAGTG
AAACACCATCAGAACAAAGAAACAAAAAAGAAAAGTGCCACTCCATCATTAAATAAAATGCTCTGCCAAAGTTTTAAGCC
ATTATTTCTGATACACATTTTTATCTGCCTTTTCTCTATTGCCTCCAATTTTAAACCTTCCCCTTTAATCCACAGACTTA
TTTTGATGAATATGTACAGCAGTTATATAATTGTCAAAGCTCCCTCCTTCCCACAGAAGTGACTCGGTTTCTTCTCGCCC
CTCCAGCAGTCCGCGAAGCACATGACCTTGCACTTCCAGCAGTGTGCCCTTAACTACTTCTCTACAACAGTCCAACCTTG
GAAAGCTTATCNTCGTTTGAGCCAGTTTCTTCACTTGCAACAAACAGANNNNGNTCTAAGANTCCTGGGGCTATTAGAAA
TAGCATTGTANCTGGACATGGTAGCTCATGCCTACNATGCCNGCACANNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34924962..34925488 507
NO GENE  


Sequence tag IST14226F2HMR1
Sequence
TAATGATGGGATTACACAGGTGCAAAAACCCTGCCTGGCAATANCTTTCTTTTAAAAACATACTTACCATTATTATGTGG
AGGTGGGTGTACTTGTGGGGGTCANAGGCCATCTTCATTGGGTTGTTTGTCTCCTGTCTTTACGTGGGCTTGGGGGAGTC
AAACTCGGATGGGTCACTTGGCTTTTGTGGCAAGTGCTTGAGCCNTCTGTTGAGTCNTCTTGCTGACCTANTAACTTTTT
TTTNNAAN
Sequence Type genomic DNA
Unitrap ID UNI29695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34925488..34925730 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]


Sequence tag IST14226F2HMF1
Sequence
NGGAGAGTGAAGCANANTGATCNNACTGAGGATAGCCTGGGCAACCTANTGAGCTTCAAGCTAATGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029106


For any suggestions or comments, please send an email to unitrap@crg.es