Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_334B10-3
Clone ID CMHD-GT_334B10-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_334B10-3
Sequence
GTTGTCTTGCATTTTTTTTTTTTGTTTTAGATTCCGACAAGTCTTCTGGGAGAAGGGTGTCACTACACTGTCTTCTTGAT
GAATTTGACAAAGATTTACCAGTTTACTTAAAGAAAGATCCTGCATATTTTTATGGATATGTGTATTTTCGACAAGTTCG
AGATAAAACTCTTAAAAGAGGCTACTTTCAAAAGTCATTGGTTTTGATCAGCAAACTACCTTATATTCTTTTTTTTCCCA
CCGTACTCAAACAGATAGCACC
Sequence Type mRNA
Unitrap ID UNI13258

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 27419122..27422601 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040818 (A630054L15Rik) NP_001127937 family with sequence similarity 116, member A Gene [Source:MGI Symbol;Acc:MGI:2442980]

 
Come back to gene ENSMUSG00000040818


For any suggestions or comments, please send an email to unitrap@crg.es