Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AZ0500
Clone ID AZ0500
Vector pGT0lxr
Project sanger

Sequence tag AZ0500
Sequence
TGAGTCATGAGAGTTTCTGTGTGATGTGTTCTGCGTGACTCTACTGGGTGTTGTGAGAGGAGGTTAGTCAAGCTCAGAAC
TCCAAACATG
Sequence Type mRNA
Unitrap ID UNI2010

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 175800091..175800178 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078889 (OTTMUSG00000016618) NP_001028295 predicted gene, OTTMUSG00000016199 Gene [Source:MGI Symbol;Acc:MGI:3706570]

 
Come back to gene ENSMUSG00000078889


For any suggestions or comments, please send an email to unitrap@crg.es