Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14587E4
Clone ID IST14587E4
Vector VICTR74
Project tigm

Sequence tag IST14587E4BBF3
Sequence
TTTTGATAATGAGGAGGAAGGGATTATTGCTAAAGACTAAGAACCAGCCATGGGCTTTTTTTGCTTTTGGTGGCACATGT
CTTTAATCCCAGCCCCTGAGAGCCTGAACCAGGCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 35259237..35259356 120
NO GENE  


Sequence tag IST14587E4HMR1
Sequence
NTAGGAGACTGCCAGANTCTGTCCTCAGTGGCGTCTTTGTCTTCACAGCGGCAGGTGCCTACCTGCCTCCCCTGCAGCAG
GTGTTTCAGGCACCCCGCCGGCCTGGCATTGGCACTGTGGGCAAACCAATCAAGCTTC
Sequence Type genomic DNA
Unitrap ID UNI10652

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 126141010..126141146 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041530 (Eif2c1) NM_153403 eukaryotic translation initiation factor 2C, 1 Gene [Source:MGI (curated);Acc:Eif2c1-001]


Sequence tag IST14587E4HMF2
Sequence
NTNNNGGGGTCNNACNNGGNCCCTNNNANNNNNACCNCTGGTCTCTTTCCNNTTTTCCTANNCNNGCNNGGGGCTTCCAC
TANCTCANACNCTCACAGGCTCACTGGTTTTTCTGGTGGCTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000041530


For any suggestions or comments, please send an email to unitrap@crg.es