Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_341B4-3
Clone ID CMHD-GT_341B4-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_341B4-3
Sequence
AGTCTGATTCAGGATGATGTCGATCTCCGGGACACTCGAAGGCACTGTGACAAGGGCAACCTTCGTGTCAAGCCCCAGCA
AGGAACTGCAGTCTTTTGGTACAACTACCTTCCTGATGGGCAAGGCTGGGTGGGTGAAGTGGACGACTACTCGTTGCATG
GGGGCTGCCTGGTCACCCGCGGCACCAAGTGGATCGCTAACAACTGGATCAATGTGGACCCTAGCCGGGCACGGCAAGCC
TTGTTCCAGCAGGAGATGGCTCGTCTGGCTCGGGAAGGTGGCATGGACTCACAACCCGAGTGGGCCTTGGACCGAGCCTA
CAGTGATGCCCGTGTGGAGCTCTGACGCAAGGCCCTGATGCGAATCACCCGCTGCCCAACGTCAAAGACCCTGCAGGTCC
TCTGTCCTACTGCAGACTGAAGTTCTGGCCGACCTCTTGCCCTAGCCCTCCCTGCCTGCAGCCGCGATCAAAGGCGCAGT
TCCTACATTCACGTTATTTATTGGTGTACAGCCTCCATGCTGCTCCGTTAAATAAAACTACAGGGCTTCCAGCCAGGAGC
CGAGAAAAAC
Sequence Type mRNA
Unitrap ID UNI13266

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108481202..108482170 438
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006675 (4933406E20Rik) NM_028944 RIKEN cDNA 4933406E20 gene Gene [Source:MGI Symbol;Acc:MGI:1921693]

 
Come back to gene ENSMUSG00000006675


For any suggestions or comments, please send an email to unitrap@crg.es