Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14746F4
Clone ID IST14746F4
Vector VICTR76
Project tigm

Sequence tag IST14746F4HMR1
Sequence
AGCATACCCAAATTTANAACCCTGGACAGATGCTCTTTCTTTACCAGGCTTTCTGCCTACTCGTCC
Sequence Type genomic DNA
Unitrap ID UNI33544

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28112514..28112578 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040488 (Ltbp4) NM_175641 latent transforming growth factor beta binding protein 4 Gene [Source:MGI (curated);Acc:Ltbp4-001]


Sequence tag IST14746F4BBF1
Sequence
CCNNGTTCCANCTCACCTGTANGTGGCCGAGGGGTGGCTGGTGGAACACGTGGCTGATTGANGGTCACTCNAGGTGGATC
T
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040488


For any suggestions or comments, please send an email to unitrap@crg.es