Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10724D1
Clone ID IST10724D1
Vector VICTR76
Project tigm

Sequence tag IST10724D1HMF1
Sequence
AGTGGCCTCTCTGTGAAATAAGCCCATGACTGANCCAATGTGCANAGGCCTCTGTGGTCCACTCTTANTGTGTGCTCCTT
TTAAAGACCCTCTCTATGCCTGTTCCTTTGACTTCTCTGTGTGCACTAACCATGCCTCAGTCCATACCCTGCTGCATGAA
CTGCTACGCATGCCGGTCCTTCCAGAAGTTGGA

Sequence Type genomic DNA
Unitrap ID UNI31512

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28929543..28929734 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026803 (Ttf1) NP_033468 transcription termination factor, RNA polymerase I Gene [Source:MGI (curated);Acc:Ttf1-001]


Sequence tag IST10724D1BBF1
Sequence
AGTGGCCTCTCTGTGAAATAAGCCCATGACTGANCCAATGTGCANAGGCCTCTGTGGTCCACTCTTAGTGTGTGCTCCTT
TTAAAGACCCTCTCTATGCCTGTTCCTTTGACTTCTCTGTGTGCACTAACCATGCCTCAGTCCATACCCTGCTGCATGAA
CTGCTACGCATGCCGGTCCTTCCAGAAGTTGGCCAGGAGGGAGCCTGGGGGAGTGAGATGTGTGGCCNCTTTGCCCCANN
ATGTTGGGCCTTAAACTGGGTAGAGTGGGACACACCTTTAATCCCAGCACTTGGGAGACAAAAGCAAGCAGATCTG

Sequence Type genomic DNA
Unitrap ID UNI31512

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28929543..28929857 305
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026803 (Ttf1) NP_033468 transcription termination factor, RNA polymerase I Gene [Source:MGI (curated);Acc:Ttf1-001]

 
Come back to gene ENSMUSG00000026803


For any suggestions or comments, please send an email to unitrap@crg.es