Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_340H1-3
Clone ID CMHD-GT_340H1-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_340H1-3
Sequence
GCAGCCACCACCAAAGTCCCTGAGATCCGAGATGTGACAAGAATCGAGCGAATCGGCGCTCACTCCCACATCCGGGGGCT
GGGACTGGATGATGCCCTGGAGCCAAGACAGGCTTCCCAGGGCATGGTGGGGCAGCTAGCTGCCCGGCGTGCAGCTGGCG
TGGTGCTGGAGATGATCCGAGAAGGGAAGATTGCAGGGCGGGCCGTCCTCATTGCAGGCCAGCCAGGCACTGGGAAGACA
GCCATTGCCATGGGCATGGCCCAGGCACTGGGCCCCGACACACCATTCACAGCCATCGCAGGCAGTGAGATCTTTTCTCT
GGAGATGAGCAAGACTGAGGCTCTAACGCAAGCCTTCCGCCGTTCCATTGGTGTCCGGATCAAGGAGGAGACAGAGATCA
TTGAAGGGGAGGTGGTAGAGATCCAGATTGACCGGCCAGCCACAGGCACGGGATCCAAGGTGGGCAAACTGACCCTCAAG
ACCACGGAGATGGAGACCATCTACGACCTGGGTACCAAGATGATCGAGTCCCTGACCAAGGACAAGGTCCAGGCCGGAGA
CGTCATCACCATCGACAAGGCCACCGGCAAGATCTCCAAGCTGGGCCGCTCTTTCACACGTGCACGGGACTACGACGCCA
TGGGCTCCCAGACCAAGTTTGTGCAGTGCCCAGACGGAGAGCTGCAGAAACGCAAGGAGGTGGTGCACACCGTGTCCCTC
CATGAGATTGACGTCATCAACTCCCGTACTCAGGGCTTCCTGGCCCTCTTCTCAGGAGACACAGGGGAGATCAAGTCAGA
AGTCCGAGAACAGATCAATGCCAAGGTGGCTG
Sequence Type mRNA
Unitrap ID UNI13274

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52679691..52686744 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003868 (Ruvbl2) NM_011304 RuvB-like protein 2 Gene [Source:MGI (curated);Acc:Ruvbl2-001]

 
Come back to gene ENSMUSG00000003868


For any suggestions or comments, please send an email to unitrap@crg.es