Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_340E10-3
Clone ID CMHD-GT_340E10-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_340E10-3
Sequence
TTTTTGTTCGCTCGCTCTGTTCTGTGCACACCAAAAAAACCAGGATGGTAGGGCCGCACATATGACATCCACTTCTACCC
CACCTTCAGGTATTTTAAAGCATTTACAAAGGAGTTTACAACGGAGAGAAAATTTTAAAGGACCTGACAGGGAGCTGCGG
ACAGTCAGGCAGACAATGATCGACTTCCTGCAGAACCATACTGAGGGCACCTGGCCTCCTGCATGCCCACCCCTGGACCC
TATTCAGTCCAGTGACATCCTTTCCTTCATGGATAGCCACAGTGGCCAATACCATGCTATTGTGTTTGAAAGCAATGGTT
CTTATGTTGGACGAGAGGTGACCTGACATTTGATTCCTGATAAAACCATCGGGGTGACCCGAACACAGTGTGCTGACAAA
ATATTTCGGGGCACCCTTGGCCTGCCTTCTCTGACTTCCTGTTACTTGATTTTCCCAAATGGATCTCAAGGACTGGTTAA
GGTTGCAAAGCCTCTACGATCGTTTTTCTCCTCTCATTTAAAATCCTTACCAGATGTAAGGAAAAAGTCACTTTTCTTGC
CTGAAAAGTCCAGC
Sequence Type mRNA
Unitrap ID UNI13279

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26076475..26083948 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036327 (Qsox2) NM_153559 quiescin Q6 sulfhydryl oxidase 2 Gene [Source:MGI (curated);Acc:Qsox2-002]

 
Come back to gene ENSMUSG00000036327


For any suggestions or comments, please send an email to unitrap@crg.es