Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_336G3-3
Clone ID CMHD-GT_336G3-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_336G3-3
Sequence
GGAAGGAGGAATGAAGTGTGTCAAGTTTTTGCTCTACGTTCTCCTGCTGGCCTTCTGCGCCTGTGCAGTGGGATTGATCG
CCATTGGTGTAGCGGTTCAGGTTGTCTTGAAGCAGGCCATTACCCATGAGACTACTGCTGGCTCGCTGTTGCCTGTGGTC
ATCATTGCAGTGGGTGCCTTCCTCTTCCTGGTGGCCTTTGTGGGCTGCTGTGGGGCCTGCAAGGAGAACTACTGTCTCAT
GATTACATTTGCCATCTTCCTGTCTCTTATCATGCTTGTGGAGGTGGCTGTGGCCATTGCTGGCTATGTGTTTAGAGACC
AGGTGAAGTCAGAGTTTAATAAAAGCTTCCAGCAGCAGATGCAGAATTACCTTAAAGACAACAAAACAGCCACTATTTTG
GACAAATTGCAAAAAGAAAATAACTGCTGTGGAGCTTCTAACTACACAGACTGGGAAAACATCCCCGGCATGGCCAAGGA
CAGAGTCCCCGATTCTTGCTGCATCAACATAACTGTGGGCTGTGGGAATGATTTCAAGGAATCCACTATCCATACCCAGG
GCTGCGTGGAGACTATAGCAATATGGCTAAGGAAGAACATACTGCTGGTGGCTGCAGCGGCCCTGGGCATTGCTTTTGTG
GAGGTCTTGGGAATTATCTTCTCCTGCTGTCTGGTGAAGAGTATTCGAAGTGGCTATGAAGTAATGTAGGGGTGGGGGGC
GTTTGGTCTTTTCATGGAGTGGATTCTCCAGGTTTTTCAATTAAACGGATTATTTTTTCAGACCT
Sequence Type mRNA
Unitrap ID UNI11290

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 128347470..128349872 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025351 (Cd63) NM_007653 CD63 antigen Gene [Source:MGI Symbol;Acc:MGI:99529]

 
Come back to gene ENSMUSG00000025351


For any suggestions or comments, please send an email to unitrap@crg.es