Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14745D8
Clone ID IST14745D8
Vector VICTR76
Project tigm

Sequence tag IST14745D8HMR1
Sequence
ACCTTAGGCAAAGATGACAGTTAATGGAGGTTTCATTGGATGGTTTACAGTATTTGACACCGTGGAAGCTCANTGAATAT
GTTACATGAATGATGAATTGACTCTATAGTTGGATAGAGATTTAAGAATTAAGGGGAGTANACCCATTTCCCCCAGTGCC
ACTGTCAGGAACAGAAAGCAGAGCTCCGAGGGTGACAGATACAGGCTGCTAGAATGGTTGGTTCCTCTAGCAAAAGCACT
GAAAGTTCANAGT
Sequence Type genomic DNA
Unitrap ID UNI5198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114603125..114603377 247
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032435 (Dync1li1) NM_146229 dynein cytoplasmic 1 light intermediate chain 1 Gene [Source:MGI Symbol;Acc:MGI:2135610]


Sequence tag IST14745D8HMF1
Sequence
NNGTTAAAGCTAACGGCAAAGGGGTTACAGAAAGGGAGAATCCAGCAATTCCCAGTCATAGACTAAAGCTAGCCCGTTGC
CTGTTTCTGTGAACAAAGTTTTATTGAAACACTGCTAGCCGGGCGTGGTGGTGCATGCCTTTAATCCCAGCACTCGGAAG
GCANAGGCAGGTGGATTTCTGANTTCCAGTACAGCCTGGTCNACANANTGAGTTCCNNGACANANNNNNNTNCACANAGA
AACCCTGTCNCNAAAAANNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032435


For any suggestions or comments, please send an email to unitrap@crg.es