Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AZ0268
Clone ID AZ0268
Vector pGT0lxr
Project sanger

Sequence tag AZ0268
Sequence
GGGGTTTTTTTGGGGGGTTTTTTTTTTTTTTGAAGAAGTGGAACGACAGCGTCAAGAAAGAAGATACATTTTGCTTGATG
AACTTGCCATAATTGTGCATCCGAACTGGGCTGCAAAAAGTGGCAAGTTTGATTGCAGCATCATGTCTTTGAGTGTCCTT
TTGGATTACAGATTGGAAGATAATAAAGAACATTCTTTTGAG
Sequence Type mRNA
Unitrap ID UNI2019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62219231..62219401 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020074 (Ccar1) NM_026201 cell division cycle and apoptosis regulator 1 Gene [Source:MGI Symbol;Acc:MGI:1914750]

 
Come back to gene ENSMUSG00000020074


For any suggestions or comments, please send an email to unitrap@crg.es