Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10846C12
Clone ID IST10846C12
Vector VICTR76
Project tigm

Sequence tag IST10846C12HMF1
Sequence
GGAGGAAAACTTGAAAGAGGTGGTGTCNAAGTTCANTGGTTCTTCCTCCCAGCCCCATGCTCCANAAATGANACTCAGAC
TCAAAATATATTTACAAATACCTTGGA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117023756..117023861 98
NO GENE  


Sequence tag IST10846C12HMR1
Sequence
TNNCTCCGACCTCCACACATGGGCCATAAATAAATGGATAAAT
Sequence Type genomic DNA
Unitrap ID UNI19527

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117023720..117023759 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es