Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13646C10
Clone ID IST13646C10
Vector VICTR74
Project tigm

Sequence tag IST13646C10BBF1
Sequence
CTACAAAGTGAGCTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCGAAAAACCA
Sequence Type genomic DNA
Unitrap ID UNI2153 UNI20549 UNI30690 UNI33109 UNI33139 UNI33575 UNI33576

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 7375094..7375153 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 34467708..34467767 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005871 (Apc) NM_007462 adenomatosis polyposis coli Gene [Source:MGI Symbol;Acc:MGI:88039]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 21928376..21928435 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22215340..22215399 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 78751591..78751650 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 11996428..11996487 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021313 (Ryr2) NP_076357 ryanodine receptor 2, cardiac Gene [Source:MGI Symbol;Acc:MGI:99685]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 55813735..55813794 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 19396654..19396713 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 14300886..14300945 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053914 (Jmjd2d) NM_173433 jumonji domain containing 2D Gene [Source:MGI (curated);Acc:Jmjd2d-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 22633787..22633846 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 9513921..9513980 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 41301178..41301237 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 17824941..17825000 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029534 (St7) NM_001083315 Suppression of tumorigenicity 7 Gene [Source:MGI (curated);Acc:St7-011]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 99735490..99735549 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3163667..3163726 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116709638..116709697 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028683 (Eif2b3) NM_175135 eukaryotic translation initiation factor 2B, subunit 3 Gene [Source:MGI (curated);Acc:Eif2b3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 31866279..31866338 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037610 (Kcnmb2) NM_028231 potassium large conductance calcium-activated channel, subfamily M, beta member 2 Gene [Source:MGI (curated);Acc:Kcnmb2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34680001..34680060 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 32952832..32952891 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038860 (Garnl3) NM_178888 GTPase activating RANGAP domain-like 3 Gene [Source:MGI (curated);Acc:Garnl3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 74848085..74848144 60
NO GENE  

 
Come back to gene ENSMUSG00000038860


For any suggestions or comments, please send an email to unitrap@crg.es