Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_329F12-3
Clone ID CMHD-GT_329F12-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_329F12-3
Sequence
CCCCCCAGCTCCTGGTGATCCGCCCAATTATCACCACCAACACATACCAACAGGTCCAACGAAATCTGGAGGTCAGGGCA
GCTGCTGCAACCGCATTTGTTCCTCCCATGGTGGGAGGCCCTCCTTTTGTGGGCCCATTTGGCTTTGGCCCTGCCGATCG
GGGTCGCCTGGACGGTCCTGAAGCTCAAGAGGCCTTGTTCCTGAGGCGAGCAGCTGTGGGCCCTCAAAGGGCCCCTATCC
TGCGTCCTGACATTCGTCCCCCAAGTGCTACCTAGAGCAGATTCTGCCCTTTCCTCTGCTTTTGGCGCCCCCCTAGCTAG
GGCACTGAGGCCTCCTTTCGAAGCCCTGGTTGGACCCCCTCTGCCTGGGCCTCCTGGACCACCCATGATGCTGCCACCAA
TGGCTCGTGCTCATGGACCAACCCTGGATTAAAAGGCTGCTCTGACACCTCCCCTGTGAACAGCCAGAAGCTCCACGAGA
GCTAGGCCTAGGCCTTGGTTTGGCCCTGAATGACAAGGA
Sequence Type mRNA
Unitrap ID UNI13299

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 31430116..31434654 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036733 (Rbm42) NP_598454 RNA binding motif protein 42 Gene [Source:MGI Symbol;Acc:MGI:1915285]

 
Come back to gene ENSMUSG00000036733


For any suggestions or comments, please send an email to unitrap@crg.es