Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_329A12-3
Clone ID CMHD-GT_329A12-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_329A12-3
Sequence
TTTAGCAAATGCATTCAAGACTTTTTCAAGGAACACCTACAAAATAAATTCTTAAATGAAGACTTTGTGTTCGATATATA
CAGGGACAGTAGGGGGAAGGTGTGGCTCATTGACTTTAATCCATTTGGGGAGGTCACAGACTCACTGTTGTTTACTTGGG
AAGAGCTAACATCTGAAAACAACCTACGTGGTGAGGTCACTGAAGGAGATGCTCAGGAGCAGGATTCTCCAGCCTTCCGT
TGCACAAACAGTGAAGTCACAGTGCAGCCCAGCCCCTATCTGAGCTTCGGGCTGCCCAAGGACTTTGTAGACCTTTCCAC
CGGGGAGGATGCTCACAAGCTCATCGATTTCCTTAAGCTGAAAAAAAATGAGCAAGAGGACGACTGAGTGCTGCTTGAAG
AACAGGCCAAGAGGGAAGCAGCTCTGGCAAAGGCCTCGCCTAGAACACAGCGAGGGGCAGGTGGTGGGCAGGGTGCAAAA
TCATTGGCTTTTATATTCATGTGTATTTACCTGGAAAAAGAGGGAGGGCCTTTGGTACTTGTAAAAAAAATAACATAATA
AATAGATCTTAAAC
Sequence Type mRNA
Unitrap ID UNI13300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 5715713..5726019 213
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039128 (Cdc123) NM_133837 cell division cycle 123 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Cdc123-001]

 
Come back to gene ENSMUSG00000039128


For any suggestions or comments, please send an email to unitrap@crg.es