Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10901H3
Clone ID IST10901H3
Vector VICTR76
Project tigm

Sequence tag IST10901H3BBF1
Sequence
AAGGAGATTCACCTTTGCTTCTAGCACATAGCCCAAACCTAATCAGATTGGTCATGAAGATGCTGTGGTACCCACCTTCC
TCAGTAACAGTTAACAAATGCCCTGCTGGTGGTTTAAACCCACAGCTATGTGTCCGCCAGAAGGTAAGACCTTGCTGTGC
TTANCTCTGGCTACAATTTATAGGTACCCAAGTCCTANTGTATAACACACTAATCTGCCCAAGGCAGGATACAGGGACTT
GCATACCTTTTGCCAACACAGTTTTAAAGATTTAAATCTGGCTAACAAACTATAAGACAAGATGTATTACTTCCTCATAC
TTCTGGAANTATAACCTTCATAATGTCCAGATATGAGCATAAGGCCACGCTTGATTTCCAACTTTTCTGAACTGTTGTTG
TTNNGCTAGCTCATCTGATTGANAAGACCNACCCCTGACATCTCANCCTTGAGCAATGTNACCTGCCCCCTCANGTTCTG
NCTGTCTACTGTGCATGGTANTTGGAAAGATTCTTCGCAATNACNGTNNTGTNANATNCNTCCN

Sequence Type genomic DNA
Unitrap ID UNI15271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20615968..20616510 503
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]


Sequence tag IST10901H3HMR1
Sequence
NNCCTTGAACTGCAAATAGGGTACCNCTTTTTATATCNCAGACTTTTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20615908..20615971 60
NO GENE  

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es