Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11537C6
Clone ID IST11537C6
Vector VICTR76
Project tigm

Sequence tag IST11537C6HMR1
Sequence
GAAAAGTGTGTGGCAGTCNGCAGATCCCAAGAGCCGGCTAAGCCTGTGACATCAGATAGGGACTTACNGGAGGTGGAGTT
TACCCTGCTGCTCTTCAGTCTTGCTGTGGTCCAGTATTTGCTCATTATGTCCCTTTTCATCCCCTTTGGAATAATAATGT
ATATTCTGTGTATGTTGGAAGTATGTAATTTGCTTTTTGANTTTACAGGGGGTTACGTTAAGAGATTGCTTTGAGTCTCA
NACAATACTCTTCTTGTTTGTTTGTTTTTTGACTTTTAAACAGTGTTGAGACTGTGAAAGAACTATGGGATATTANAAAT
TAGATTAAATGCATTTTGCACTGTGTATGTCTACAAGTCCATGGGGCCAGGGAGTGNAATATGGTGGTTNGAATGANNCT
ANNCN
Sequence Type genomic DNA
Unitrap ID UNI27871

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108282554..108282954 383
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011831 (Evi5) NM_007964 ecotropic viral integration site 5 Gene [Source:MGI (curated);Acc:Evi5-001]

 
Come back to gene ENSMUSG00000011831


For any suggestions or comments, please send an email to unitrap@crg.es