Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14209G8
Clone ID IST14209G8
Vector VICTR74
Project tigm

Sequence tag IST14209G8HMR1
Sequence
AAGAGAATAGTTGTTTTTATTATAGCTAAATAAGAAAAGAGAGGAAGTTTAAACATGAGCAAGCTGGGGACGAAAATCTT
CTGTCTCCAATTACGTATTATTTTTCTAACCCTCCCATGCCTTGACTGAATTCATTGAAATAGACTGAATCTGTGGGATA
GCACACAGGGCTGGGCTGAGAGTTTGTATTTGACCCTCTGGTACTTTATTAGTCTCCACAAACTTTGTACCATTGAGGTA
AAACCCCANGNNCTTGCATAGCTCTGGGGCTGGGGAGGTCCCAAACTCTCCATTTGAACCNNTACTGAATTTTGAATCTT
CATAAATTGAAATAATGGCATGGTATATCTTCAGGTTANAAGAGGACCTGACAGANAGGTGTTGGAAGANAGACCATCTT
GTGTATTGTATGNNTNCCN
Sequence Type genomic DNA
Unitrap ID UNI27121

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76364424..76364835 396
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048490 (Nrip1) NM_173440 nuclear receptor interacting protein 1 Gene [Source:MGI (curated);Acc:Nrip1-001]


Sequence tag IST14209G8HMF1
Sequence
CTCTTAATAAAAGATAGAACCAAAAACCCGCTCTTGTAGCTTTTATGGGAATCCTTTATTTCCCAACATTTACTGAGCAA
TTCACCATCCAAAGCACACTATAAGATATTATGTATATTCGCTTTCTGTGTCACTCTACGTCTGCAATACAGTTCCAACT
TGTGCTTTTCGGTGTTATGAGGAAGTACTCAGTTAGAGTGGTTTGGGGTTCAACATTCCATAAATTTTAAATAAGTGAAG
TAAAAAAAGGGGGGACGGGAGGTTTATAACTCCATTCCTCATGGCCTCGACAATAAAAGCGTATGGCTGGTGTGTATTTA
AAAATGTACTCTGTGCTTCAAACCCCCTANTTCAAGACAGCTCCCTCCTCATCAAGCTCTGCTGCCCNTANGAAGCNNAG
TCCTCCTTANCTCTCTCAATAAACTCACGAATGCCTTANCCATTTTCTGCTTGGAGCTCGGANNNTCCTTTTGTAACATG
CNNTATANTCTTTAAGGAACCCNNTNNGGGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76364831..76365341 477
 
EST/CDNA Est Name
  CO430206.1 - BY752316.1 - BB611186.1 - AW990482.1 - AW047215.1 - CJ110211.1 - CJ111230.1 - CJ120900.1 - CJ114260.1 - CJ118209.1 - CJ107954.1 - CJ111885.1 - CJ121274.1 - CJ117196.1 - CJ128064.1 - BB638015.1 - BB617901.1 - CD803828.1 - BY718152.1

 
Come back to gene CO430206.1 - BY752316.1 - BB611186.1 - AW990482.1 - AW047215.1 - CJ110211.1 - CJ111230.1 - CJ120900.1 - CJ114260.1 - CJ118209.1 - CJ107954.1 - CJ111885.1 - CJ121274.1 - CJ117196.1 - CJ128064.1 - BB638015.1 - BB617901.1 - CD803828.1 - BY718152.1


For any suggestions or comments, please send an email to unitrap@crg.es