Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11095H1
Clone ID IST11095H1
Vector VICTR76
Project tigm

Sequence tag IST11095H1HMF2
Sequence
NACNAGGCAGTCAGTCCTCTGTTACATATATGCCAGGGGCACAGACCNNCCCATGTATGCTCTTTGGTTGGTGGCTTANT
CTCTGGGAGCTCCCAGGGGTCCGAGTTAGTTA

Sequence Type genomic DNA
Unitrap ID UNI2494

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53711010..53711119 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000708 (Kat2b) NM_020005 K(lysine) acetyltransferase 2B Gene [Source:MGI Symbol;Acc:MGI:1343094]


Sequence tag IST11095H1BBF1
Sequence
AGGCCTGAATCTGATTTGGGGCTAGAACAAAGAAGTAGGCCTCAGGCATGAATATGATTTTGGGTTAGGATGGGGAAGTA
GGCTCTGCTATCTTGGTCACCCTGATTAGCCCTTAGAAAAAGTGATCTTGGGACATTGTTTATTGCCTTGCTCGTTCCTT
GACTATTTGTGTTTATTGTCTTGTTTGTTCCTTAACCTAGAACTGACCTTTTTACTTGCATGTAATTAAAATGGTAAAAA
AGCAGATTGGGAAAAAAATAAAAGCATCTCAGCCTCTGAACTGGCTGGGGTCATGCTACAGTGTTGTCTAATTGTCTTTT
TCTCTTTTTAATCCTCATTCCTGCCCTGGAGAAACTGTTGACTGACTGANCTGGTTTGGTTACNCTATCCCAGTCCAAGA
CCTGTGTCTATCCCTTAAAAGCATGTAAGANCTAAGTACACTTCCTANGGANAAACCCACTGTTCATCACCCANTAGGCA
GGCNCGTCCNACGACNAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114460782..114461276 479
 
EST/CDNA Est Name
  BB421125.1 - BI694075.1

 
Come back to gene BB421125.1 - BI694075.1


For any suggestions or comments, please send an email to unitrap@crg.es