Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14063F9
Clone ID IST14063F9
Vector VICTR74
Project tigm

Sequence tag IST14063F9BBF1
Sequence
GGGACTGAGTTGACATTTTACAGAAAAACAAACAGTTTCCAAAGCAGAATCCATTTCATGGTCCTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI14558

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5850108..5850177 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043488 (AC142098.2) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q8CEY4]

 
Come back to gene ENSMUSG00000043488


For any suggestions or comments, please send an email to unitrap@crg.es