Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_335G9-3
Clone ID CMHD-GT_335G9-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_335G9-3
Sequence
AAAAAGGAATGGCCAGTGAGGAGGCTGAAGTTGACCTGCGGGACCCTGGCATAGACTATGAGTTGTACAAATACACTTGC
CAGGAGCTACAAAGGCTGATGGCCGAGATCCAGGACCTGAAGAGTAAGGGCAGCAAGGACCTGGCCATTGAAATTGAAGA
ACGAAGGATCCAGAGCTGTGTGCACTTCATGACTCTAAAGAAGCTTAACCGATTAGCCCACATCAGATT
Sequence Type mRNA
Unitrap ID UNI13314

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4801169..4802174 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034274 (Thoc5) NM_172438 THO complex 5 Gene [Source:MGI (curated);Acc:Thoc5-001]

 
Come back to gene ENSMUSG00000034274


For any suggestions or comments, please send an email to unitrap@crg.es