Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_340A8-3
Clone ID CMHD-GT_340A8-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_340A8-3
Sequence
GAAGAAGGACAAAGAGCGCGGGGAAATCGAGGTCGACATCCAGTTTATGAGGAATAACATGACGGCCAGCATGGTTTGAC
CTCTCCATGAAAGACAAGTCCCGGAATCCATTTGGAAAACTGAAGGACAAGATCAAAGGGAAGAATAAGGACAGCGCCTC
GGATACCGCCTCGGCCATCGTCCCCAGCGTGACACCCTCAGTCGACAGTGACGATGAGTCCTTCTCG
Sequence Type mRNA
Unitrap ID UNI13318

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 28266889..28267114 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031488 (Rab11fip1) NM_001080813 RAB11 family interacting protein 1 (class I) Gene [Source:MGI Symbol;Acc:MGI:1923017]

 
Come back to gene ENSMUSG00000031488


For any suggestions or comments, please send an email to unitrap@crg.es