Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14225D5
Clone ID IST14225D5
Vector VICTR74
Project tigm

Sequence tag IST14225D5HMR1
Sequence
TTATGACCTTAGGGCAGGGTGCTCGGTGCCTCAGTTTCCCCATCTACGCAAAGGACCGCGTGTCCAGTGTCTCCATATGC
GCTTTTTNAAGGTTTTAAATCTCTGAAATCATCGAGTCTGATCCGGGTCTCTTCGTAATAAACTGATCTGCAGGCAAGAA
GACAGAAGAACTAGCCACTTGGGTGACTAGTCCGAGGTCACACAGAGTGAANAGCANACCTGGTCCTTTGTATNAGGGTT
TANAGAGCTGATGANTGANGAANCCTGGCCNNTANCTAGNNNGNGNGGG
Sequence Type genomic DNA
Unitrap ID UNI18859

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 62022050..62022328 257
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066150 (Slc31a1) NM_175090 solute carrier family 31, member 1 Gene [Source:MGI (curated);Acc:Slc31a1-001]


Sequence tag IST14225D5BBF1
Sequence
ATAACAGCAATGTCGCTGTAAGATCCCTGCCACTGTTCGGCTCAGATCCCATGACTTCTAGTCCGGGGCTCTTTCTCCTT
CCGCCCAGCTTAAGGGAGCTGCGGGGGGTCCAGGGTTCGGGAGGGAAAAGGACAGCGAACACGCCGGGTTTGGGAAAAGG
AGGGGAGTGACCTTACCTTCACAGGGTAAGCCCCGCCGCCTTANTCTTCCTCTCAGAACTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 62021829..62022053 223
NO GENE  

 
Come back to gene ENSMUSG00000066150


For any suggestions or comments, please send an email to unitrap@crg.es