Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10090H2
Clone ID IST10090H2
Vector VICTR75
Project tigm

Sequence tag IST10090H2BBR1
Sequence
CTGGGGGTTGTCTTAATCCCCACTGTGGTAATTCTGGTACTCTCCGCATTTGGGATTTGGGGGCAGGAAGAATTCAAGGC
CAGCCTCATGGGGAGTTCAAGGTCAGTATGAGCTATTTGAAACCAGCTCAAAAACAAAACAGCTGTTGAGTGTGGTGGTC
TTGCCTGAGATCCCAGTGCTGGGGAGGCTGGAGTAAAATCAGGAGTTCAAGGCCAGCCTGGGCCACAGAAGACCCTGACC
CACTTACTCTGCCACTCCCTCTCCACACCCATGACTTTTTCAAAATTACTAAAGTAGATGATCTTGTGTGCATGCAGGTC
AGGCTCCGCAGATTGCCCTGTCAGGCTCATTAAGGCATTCCAGTTGACAGAAGTGGCCTTTTAGGTTGCATCCCGAGGTC
TGCAGAGCTCCGGGATCCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 25033652..25034069 418
NO GENE  


Sequence tag IST10090H2BBF2
Sequence
GCTTTGGCAGTTCCCAGGTGGTACAAACTCTCACCTAAGCAGACTAAATTCCTAAGTTCCTTGGAGTCCCGGCACCAAGA
TGGCGACCGCTGCTGCTGTGGCTTAGGTCGCCTCCCCAGCCGGGCGGGCACCTGTCCTCTGGTCCGGAAGATGGCCGGCT
GTCCCCGGCCCACACAGGGTGCTGCCTCAGCCCCTCTGTGCTTTTGCCTGTTCCAGAAGCTGTCAGGTTCTCTGGCGCAC
CCTCTCACCTGTTCAGACTAATTTCCTAAGTTCGGCGGGTTCCGGACCAAGATCTGTC
Sequence Type genomic DNA
Unitrap ID UNI30811 UNI31343 UNI31345 UNI33582

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21293086..21293378 281
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 50427564..50427856 281
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 21687572..21687864 281
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051341 (Zfp52) NM_144515 zinc finger protein 52 Gene [Source:MGI Symbol;Acc:MGI:99199]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 87112591..87112883 281
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 58444832..58445124 281
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037106 (AC107772.19-201)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 6882968..6883260 281
 
EST/CDNA Est Name
  BY302409.1 - BX512183.1 - AW320348.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 43846224..43846516 281
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 38066518..38066810 281
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 50092519..50092811 281
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 44245896..44246188 281
 
EST/CDNA Est Name
  BG101023.1 - BU583040.1 - CA465568.1 - CA566997.1 - BY302409.1 - BX512183.1 - AW320348.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 9746968..9747260 281
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 50659847..50660139 281
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 24235283..24235575 281
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 70524303..70524595 281
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 16750008..16750300 281
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 81554221..81554513 281
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 5055132..5055424 281
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 87629921..87630213 281
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 14209764..14210056 281
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026712 (Mrc1) NM_008625 mannose receptor, C type 1 Gene [Source:MGI (curated);Acc:Mrc1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11616430..11616722 281
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057715 (A830018L16Rik) NM_177173 RIKEN cDNA A830018L16 gene Gene [Source:MGI Symbol;Acc:MGI:2444149]

 
Come back to gene ENSMUSG00000057715


For any suggestions or comments, please send an email to unitrap@crg.es