Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14661E8
Clone ID IST14661E8
Vector VICTR74
Project tigm

Sequence tag IST14661E8HMR1
Sequence
TACACCTTCTGATGATGGCCTCTGGTCCCTGTGCTCACAGCAGAATGTTAAAGCCTAGCAGGCAGAGAGGCTGACAGAAG
TACAAGGT
Sequence Type genomic DNA
Unitrap ID UNI30557

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117085353..117085440 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]


Sequence tag IST14661E8BBF1
Sequence
NTAANCCCCANNTATTCTAGTGAANTTTTGCTGTCCCGGTCNTTTGTGTCCNCCATTTGTANCGTCNCCCCANCGCTANC
CTGCCTTGTNCCCAGANCGCATGATTTCTGAGGAGCTTCANAAATGCCTTACATCACTGGANAAGCTTAGGAAGGACCTG
GAAGGCTGCCTAAANCACANACTGCCNGGCCTGCATCCTGGGTCTCTGGGCCTGACNACTGGATGANCATCTTTGGGTGA
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14661E8HMF1
Sequence
GTAAGCCCCAAGTATTCTAGTGAAGTTTTGCTGTCCCGGTCATTTGTGTCCACCATTTGTAGCGTCGCCCCAGCGCTAGC
CTGCCTTGTACCCAGAGCGCATGATTTCTGAGGAGCTTCAGAAATGCCTTACATCACTGGAGAAGCTTAGGAAGGACCTG
GAAGGCTGCCTAAAACACAGACTGCCAGGCCTGCATCCTGGGTCTCTGGGCCTGACGACTGGATGAGCATCTTTGGGTGA
TGTGGATGCTCTTGGTTAAGGGACTGGGTTTTCTGTTTGTTTGTTTTGGTTGGTTGGTTTNTGTTNNANTNNGTGTNNGT
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117085438..117085753 304
NO GENE  

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es