Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_320C1-3
Clone ID CMHD-GT_320C1-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_320C1-3
Sequence
GAAAAGAACCAGCGGGTCCCTGCTGACATGATCTTCCTGAGGACGTCAGAGAAAAACGGCTCTTGCTTCTTGCGCACGGA
TCAGCTGGATGGAGAGACAGACTGGAAGCTTCGGCTCCCGGTGGCCTGCACACAGAGGCTTCCCACGGCTGCTGACCTCC
TGCAGATTCGGTCCTATGTGTACGCTGAAGAGCCCAACATCGACATTCACAACTTCCTGGGGACTTTCACCAGGGAGAAT
GGCGCTCATTCCATCCTTGGGAGTGCGACCCTGACGGAGCCCGAGGGGGCCAACTGCTGTGTCTATTTAAGGTTCCTTAC
CAAAGCCGATCCAGCCTTGGAGGCAGAACGGGGCATTTCTGTGGGGACAGCACACCTGGAATGTGTTGTGTCTGGCTCTG
GCT
Sequence Type mRNA
Unitrap ID UNI13328

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168509044..168514852 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027546 (Atp9a) NM_015731 ATPase, class II, type 9A Gene [Source:MGI (curated);Acc:Atp9a-003]

 
Come back to gene ENSMUSG00000027546


For any suggestions or comments, please send an email to unitrap@crg.es