Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14270C8
Clone ID IST14270C8
Vector VICTR74
Project tigm

Sequence tag IST14270C8HMF1
Sequence
GTTTTTTTGTTTGTTTTGGTTTTTCGAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGCACATTGGATTTTATGAC
AGAGTGTGTGTGCGTGTGTGTGTGTGTGTGTGTGTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14270C8BBF2
Sequence
GTTTTTTTGTTTGTTTTGGTTTTTCNAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGCN
Sequence Type genomic DNA
Unitrap ID UNI18497

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 11161851..11161911 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 135394353..135394413 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 122152792..122152852 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028121 (Bcar3) NM_013867 breast cancer anti-estrogen resistance 3 Gene [Source:MGI Symbol;Acc:MGI:1352501]

 
Come back to gene ENSMUSG00000028121


For any suggestions or comments, please send an email to unitrap@crg.es