Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14942E6
Clone ID IST14942E6
Vector VICTR76
Project tigm

Sequence tag IST14942E6HMF2
Sequence
CTTAACATTTCCTAAGAATTCCATTTACTGTCCAGTAACACTTTCAGGAGCGTGTGCCTGACGAGTCTTCACACTGACTA
CGGTTTTCTCTTTGCAAAGGAAAAGGACTCTTGCCAGTAGCTGGGACTTGGTTGAATGCTTCTCTAAGATGACTAACGAT
AGCTGGGACGCCCAGTGACAAGGCTTGTGGCTTCCCAGGCCTCCAGCCCTCACCTTCGGAAATACAACTAACTGTCCAAG
CGACCCAAGAGATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 59776109..59776363 255
 
EST/CDNA Est Name
  NM_027307.4


Sequence tag IST14942E6BBF1
Sequence
ACCCAGGAGCTTGTAGATTCTCCTCAGCCAGAGAGCCCGCCTGCCTCCAGGGTTACAGATGGCCATGTTGCCTGTTTTTT
TTTTTTNNNTTTTTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI29636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57289108..57289220 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038764 (Ptpn3) NP_035337 protein tyrosine phosphatase, non-receptor type 3 Gene [Source:MGI (curated);Acc:Ptpn3-001]

 
Come back to gene ENSMUSG00000038764


For any suggestions or comments, please send an email to unitrap@crg.es