Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14757D2
Clone ID IST14757D2
Vector VICTR76
Project tigm

Sequence tag IST14757D2HMF1
Sequence
TTAGTAAACAGAGGCAGACCTCACATCAGATAGCTAGGAAAACTCACTTGAAACTTCAGAAGCATGGGGAGAAGGTTGTC
CTCTGCTTTGGGGTCTGTAGGATTTCAACTCTCTTCTGCTGCTTTGGTGGAGCTAGCCCTGCCCAGTGCACTTGCNNAGG
CTGGAGGANCGGTGGCNNATGGGGACATGTTGGCTTANTNCN
Sequence Type genomic DNA
Unitrap ID UNI33587

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4138816..4139012 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024842 (Cabp4) NM_144532 calcium binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1920910]


Sequence tag IST14757D2HMR1
Sequence
TTGTCCCTCACTGGCTCTCCTGGTCTANGATACAAAAGGCCACANCTCTACCCTCACTTATATTTCCCAATCTGAGGCAC
AAGAAGGAGGCCTTGGCATGTANGCGCAGGAAGGAATACAGATGANAATTACCCTCAACCCCCCCACCCGGAGACCCCCC
CCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4139035..4139197 155
NO GENE  

 
Come back to gene ENSMUSG00000024842


For any suggestions or comments, please send an email to unitrap@crg.es