Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_320H9-3
Clone ID CMHD-GT_320H9-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_320H9-3
Sequence
GCGCTTTGGTTCCAGACGGAGGGCCTGGTGGAGGGTGTGCGGGCCTTTTGTGCCCCATATCCCATTTGATTTTTATTTGT
GTGAAATGGCTTTTCCCCGGGTCAAGCCAGCACCTGATGAGACCTCCTTCAGTGAAGCCTTGCTGAAAAGGAATCAAGAC
CTTGCCCCTAATTCTGCTGAGCAGGCTTCCATCCTTTCTTTGGTGACAAAAATCAACAATGTGATTGACAACTTGATTGT
GGCCCCAGGAACATTTGAAGTGCAAATTGAAGAAGTCCGGCAGGTAGGATCATATAAAAAGGGAACAATGACTACAGGAC
ACAATGTGGCTGACCTGGTGGTAATACTAAAGATCCTGCCAACATTGGAAGCTGTTGCTGCCCTGGGGAACAAAGTCGTG
GAAAGCCTAAGGGCACAGGATCCCTCAGAAGTTTTGACCATGCTGACTAATGAAACTGGCTTTGAAATTAGCTCTTCTGA
TGCTACGGTGAAAATTCTCATTACAACAGTGCCCCCCAATCTCCGAAAACTGGATCCAGAACTCCATTTGGACATCAAGG
TGTTGCAAAGCGCCTTAGCAGCCATCCGGCATGCCCGCTGGTTTGAAAAGAACGCTTCTCAGTCCACAGTTAAAGTTCTC
ATAAGATTGCTAAAGGACTTACGGATTCGTTTTCCTGGCTTTGAGCCTCTCACACCCTGGATCCTTGACCTACTTGGGCA
CTATGCTGT
Sequence Type mRNA
Unitrap ID UNI13335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 90280954..90290195 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001016 (Ilf2) NM_026374 interleukin enhancer binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:1915031]

 
Come back to gene ENSMUSG00000001016


For any suggestions or comments, please send an email to unitrap@crg.es