Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11793D6
Clone ID IST11793D6
Vector VICTR76
Project tigm

Sequence tag IST11793D6HMF1
Sequence
CCCTACAGTTCCAGCTGAGCTGAGAAAGGCCAGGATTCCCACACAGAACACTGCAAACCAGAGAAACAAGAGCCCTTAGT
AAGGTTTCTGGATTTAGCAAACAGATATGACTAAATTTAAATTTCAGATAAAGAAACATTAATATTTGGCATAATTATGT
CTCACATAATAGTTGGAAAATATTTAGATAAATTGTTTGCCTGCAATTCATAGTCTACTGGGATACTATGGTTTTCTTAT
CAACACGGTAAGTTAAGACAAAGTGAATTTGAAATAGCAGACTTCTGACTATACAGCTGCTACTGGGTCTCCAGGCTTGC
CGGACCCTGAAATCTGCCCTGGCTCCAGTTGATAGCACATCTTCTTGTTCCTCTGCTGAATAGAAGCNAACAGCCTATGT
CCTATCGCTGANGGCCAGCACATAGCCTGGAGCTTCTGCAGACCCTTCCGGCTGTCTGCCACTTTCTGTTTCTGAGCTGA
NGGACNCCTTN
Sequence Type genomic DNA
Unitrap ID UNI33589

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 59054973..59055462 482
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055254 (Ntrk2) NM_008745 neurotrophic tyrosine kinase, receptor, type 2 Gene [Source:MGI Symbol;Acc:MGI:97384]

 
Come back to gene ENSMUSG00000055254


For any suggestions or comments, please send an email to unitrap@crg.es