Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10657H3
Clone ID IST10657H3
Vector VICTR76
Project tigm

Sequence tag IST10657H3BBF1
Sequence
AAACCTTGGTGGGATTCAAACTCAAAGCAGTCCTCCTTGGCTCTGCCTCCGTAGGACTGANATTACAGCTCTGTGTCTCT
ACTTCTGACCCGTAGGGGCTTCTCTGGCAGCCTTCATTGCTAGCTTTTGCCTCCTTCATCTGTCCGGGATGCANAAAGAA
AGTGGATTTTGTTTTGTTTTGCGTGGACTACGCGTTGCATCATCCCCAGCAAAATGGGGTTTGCCCGGTGTCNGCATCCT
CCTCCTGCCTCTANNCTNNGCATGTGACTTGAAGTANTGTCAGGTGGTGTGCTCGGACTGGCCCGANTGGGTGTGGTGTG
GTGGCTGATCACTCTCCTGTCNNCTGGCCCANCANATGGAGGTGCTTGCCTCTANGCACANTGTTGGGACTGAGTGAAAT
CCCANGATCT

Sequence Type genomic DNA
Unitrap ID UNI10487

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 32017571..32017979 377
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039262 (5830434P21Rik) NM_172661 RIKEN cDNA 5830434P21 gene Gene [Source:MGI Symbol;Acc:MGI:1923304]

 
Come back to gene ENSMUSG00000039262


For any suggestions or comments, please send an email to unitrap@crg.es